Stem-loop sequence rno-mir-674

AccessionMI0006159 (change log)
DescriptionRattus norvegicus miR-674 stem-loop
Gene family MIPF0000394; mir-674
Literature search

9 open access papers mention rno-mir-674
(25 sentences)

Stem-loop
   --           ca             g     ag  u 
5'   ccugagccuug  cugagaugggagu gugua  gc c
     |||||||||||  ||||||||||||| |||||  ||  
3'   gggcucggaac  gacucuacccucg cacgu  ug a
   gu           aa             a     -a  g 
Get sequence
Deep sequencing
47548 reads, 10 reads per million, 488 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 108864462-108864538 [+]
intergenic
Database links

Mature sequence rno-miR-674-5p

Accession MIMAT0005329
Sequence

11 - 

gcacugagaugggaguggugua

 - 32

Get sequence
Deep sequencing11418 reads, 455 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-674-3p

Accession MIMAT0005330
Sequence

46 - 

cacagcucccaucucagaacaa

 - 67

Get sequence
Deep sequencing36128 reads, 486 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).