Stem-loop sequence rno-mir-673

AccessionMI0006158 (change log)
DescriptionRattus norvegicus miR-673 stem-loop
Gene family MIPF0000405; mir-673
Literature search

3 open access papers mention rno-mir-673
(4 sentences)

Stem-loop
   --  cu a    cu     cu -       u     uc  ga 
5'   gc  g gggg  cacag  c cgguccu ggagc  ca  g
     ||  | ||||  |||||  | ||||||| |||||  ||  a
3'   cg  c cccc  guguc  g gucaggg ccucg  gu  a
   cc  uu c    ac     uu a       -     uu  aa 
Get sequence
Deep sequencing
33276 reads, 18.8 reads per million, 336 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133691381-133691463 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-673
rno-mir-770chr6: 133682965-133683040 [+]
rno-mir-673chr6: 133691381-133691463 [+]
rno-mir-493chr6: 133699509-133699592 [+]
Database links

Mature sequence rno-miR-673-5p

Accession MIMAT0005328
Previous IDsrno-miR-673
Sequence

11 - 

cucacagcuccgguccuuggag

 - 32

Get sequence
Deep sequencing3345 reads, 230 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-673-3p

Accession MIMAT0017313
Previous IDsrno-miR-673*
Sequence

51 - 

uccgggacugaguucugugcac

 - 72

Get sequence
Deep sequencing29930 reads, 322 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).