Stem-loop sequence rno-mir-671

AccessionMI0006156 (change log)
DescriptionRattus norvegicus miR-671 stem-loop
Gene family MIPF0000358; mir-671
Literature search

1 open access papers mention rno-mir-671
(1 sentences)

Stem-loop
   ---ca        a   a      ga           -u   g 
5'      ggaagagg gga gcccug  ggggcuggagg  gau g
        |||||||| ||| ||||||  |||||||||||  |||  
3'      cuuucucc ccu cgggac  ucuuggccucc  uug a
   ccgag        a   -      --           uu   u 
Get sequence
Deep sequencing
29849 reads, 4.73 reads per million, 486 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 7108747-7108827 [-]
sense
ENSRNOT00000062099 ; Mir671-201; exon 1
ENSRNOT00000014082 ; Chpf2-201; exon 4
Database links

Mature sequence rno-miR-671

Accession MIMAT0005326
Sequence

50 - 

uccgguucucagggcuccacc

 - 70

Get sequence
Deep sequencing24079 reads, 479 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).