Stem-loop sequence rno-mir-532

AccessionMI0006154 (change log)
DescriptionRattus norvegicus miR-532 stem-loop
Gene family MIPF0000113; mir-188
Literature search

8 open access papers mention rno-mir-532
(12 sentences)

Stem-loop
   --uu       c  u      a    a   ---cu     c 
5'     uucucuu ca gccuug gugu gga     guuga a
       ||||||| || |||||| |||| |||     |||||  
3'     gagagga gu cggaac caca ccu     uaauu u
   gaac       c  u      c    c   cccau     c 
Get sequence
Deep sequencing
156358 reads, 94.9 reads per million, 491 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 16109870-16109948 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-532
rno-mir-532chrX: 16109870-16109948 [+]
rno-mir-188chrX: 16110270-16110349 [+]
rno-mir-362chrX: 16117170-16117234 [+]
rno-mir-3560chrX: 16117863-16117974 [-]
rno-mir-501chrX: 16117874-16117957 [+]
Database links

Mature sequence rno-miR-532-5p

Accession MIMAT0005322
Sequence

11 - 

caugccuugaguguaggacugu

 - 32

Get sequence
Deep sequencing140941 reads, 491 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-532-3p

Accession MIMAT0005323
Sequence

48 - 

ccucccacacccaaggcuugca

 - 69

Get sequence
Deep sequencing15415 reads, 484 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).