Stem-loop sequence rno-mir-500

AccessionMI0006153 (change log)
DescriptionRattus norvegicus miR-500 stem-loop
Gene family MIPF0000139; mir-500
Literature search

10 open access papers mention rno-mir-500
(51 sentences)

Stem-loop
   -cc  c     -         uau ug     uuag   uau 
5'    cc ucucu aauccuugc   c  ggugc    ugc   c
      || ||||| |||||||||   |  |||||    |||   u
3'    gg agaga uugggaacg   g  ccacg    acg   c
   agu  a     c         --- gu     --ua   uaa 
Get sequence
Deep sequencing
12259 reads, 0.208 reads per million, 481 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 16121332-16121411 [+]
sense
ENSRNOT00000054385 ; Mir500-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-500
rno-mir-362chrX: 16117170-16117234 [+]
rno-mir-3560chrX: 16117863-16117974 [-]
rno-mir-501chrX: 16117874-16117957 [+]
rno-mir-500chrX: 16121332-16121411 [+]
Database links

Mature sequence rno-miR-500-5p

Accession MIMAT0017311
Previous IDsrno-miR-500*
Sequence

11 - 

aauccuugcuaucugggugcuuag

 - 34

Get sequence
Deep sequencing244 reads, 146 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-500-3p

Accession MIMAT0005321
Previous IDsrno-miR-500
Sequence

49 - 

aaugcaccugggcaaggguuca

 - 70

Get sequence
Deep sequencing12014 reads, 480 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).