Stem-loop sequence rno-mir-495

AccessionMI0006152 (change log)
DescriptionRattus norvegicus miR-495 stem-loop
Gene family MIPF0000110; mir-329
Literature search

9 open access papers mention rno-mir-495
(66 sentences)

Stem-loop
   --uac u          u  -       --a   u    uuu 
5'      c gaaaagaagu gc ccauguu   uuu ucgc   u
        | |||||||||| || |||||||   ||| ||||    
3'      g uuuuucuuca cg gguacaa   aag agug   a
   cuaua c          -  u       aca   c    uuu 
Get sequence
Deep sequencing
28129 reads, 14.2 reads per million, 337 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133868288-133868367 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-495
rno-mir-411chr6: 133858849-133858924 [+]
rno-mir-299bchr6: 133859295-133859412 [-]
rno-mir-299achr6: 133859324-133859386 [+]
rno-mir-3579chr6: 133860473-133860585 [-]
rno-mir-380chr6: 133860490-133860566 [+]
rno-mir-323chr6: 133861199-133861284 [+]
rno-mir-758chr6: 133861498-133861575 [+]
rno-mir-329chr6: 133862168-133862264 [+]
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
rno-mir-376cchr6: 133872439-133872522 [+]
rno-mir-376bchr6: 133873095-133873180 [+]
rno-mir-3595chr6: 133873587-133873706 [-]
rno-mir-376achr6: 133873605-133873686 [+]
rno-mir-300chr6: 133874152-133874230 [+]
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
Database links

Mature sequence rno-miR-495

Accession MIMAT0005320
Sequence

49 - 

aaacaaacauggugcacuucuu

 - 70

Get sequence
Deep sequencing27922 reads, 337 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).