Stem-loop sequence rno-mir-463

AccessionMI0006149 (change log)
DescriptionRattus norvegicus miR-463 stem-loop
Gene family MIPF0000425; mir-463
Literature search

4 open access papers mention rno-mir-463
(9 sentences)

Stem-loop
   -ac   -g          u   u    ---      g  a 
5'    ccu  uuuuaccuaa uug uguc   caucau ua a
      |||  |||||||||| ||| ||||   |||||| || a
3'    gga  gagauggguu aac gcag   guagug au u
   cuc   ag          u   c    aua      a  u 
Get sequence
Deep sequencing
13137 reads, 299 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 151276029-151276106 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-463
rno-mir-881chrX: 151283910-151283986 [-]
rno-mir-878chrX: 151283461-151283537 [-]
rno-mir-880chrX: 151281988-151282065 [-]
rno-mir-463chrX: 151276029-151276106 [-]
rno-mir-741chrX: 151274356-151274451 [-]
rno-mir-3551chrX: 151272824-151272905 [-]
rno-mir-471chrX: 151272104-151272181 [-]
Database links

Mature sequence rno-miR-463-5p

Accession MIMAT0017309
Previous IDsrno-miR-463*
Sequence

10 - 

uaccuaauuuguuguccauca

 - 30

Get sequence
Deep sequencing11224 reads, 94 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-463-3p

Accession MIMAT0005317
Previous IDsrno-miR-463
Sequence

47 - 

ugauagacgccaauuuggguag

 - 68

Get sequence
Deep sequencing1899 reads, 41 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).