Stem-loop sequence rno-mir-455

AccessionMI0006148 (change log)
DescriptionRattus norvegicus miR-455 stem-loop
Gene family MIPF0000129; mir-455
Literature search

13 open access papers mention rno-mir-455
(53 sentences)

Stem-loop
   ---  u ug  c          u      a   c   ga 
5'    gg g  ag guaugugccu uggacu cau gug  c
      || |  || |||||||||| |||||| ||| |||  g
3'    cu c  uc cauauacggg accuga gua cac  c
   gaa  c gu  a          c      c   c   ga 
Get sequence
Deep sequencing
52024 reads, 2.49 reads per million, 481 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 79097208-79097285 [+]
sense
ENSRNOT00000010333 ; Col27a1-201; intron 10
Database links

Mature sequence rno-miR-455-5p

Accession MIMAT0005316
Previous IDsrno-miR-455
Sequence

11 - 

uaugugccuuuggacuacaucg

 - 32

Get sequence
Deep sequencing26526 reads, 474 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-455-3p

Accession MIMAT0017308
Previous IDsrno-miR-455*
Sequence

48 - 

gcaguccacgggcauauacacu

 - 69

Get sequence
Deep sequencing25477 reads, 471 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).