Stem-loop sequence rno-mir-434-1

AccessionMI0006147 (change log)
Previous IDsrno-mir-434
DescriptionRattus norvegicus miR-434-1 stem-loop
Gene family MIPF0000439; mir-434
Literature search

7 open access papers mention rno-mir-434-1
(86 sentences)

Stem-loop
   -   ug     -c  c    c c      ug      -u u 
5'  guu  aacca  ag ucga u augguu  aaccau  g c
    |||  |||||  || |||| | ||||||  ||||||  | a
3'  uaa  uuggu  uc agcu a uaccaa  uuggug  c a
   c   gu     cc  -    c c      gu      cu a 
Get sequence
Deep sequencing
5271345 reads, 3.49e+03 reads per million, 487 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133715378-133715458 [+]
antisense
ENSRNOT00000062197 ; Mir3543-201; exon 1
ENSRNOT00000072399 ; rno-mir-3543-201; exon 4
Clustered miRNAs
< 10kb from rno-mir-434-1
rno-mir-337chr6: 133705920-133706016 [+]
rno-mir-3544chr6: 133705932-133706019 [-]
rno-mir-540chr6: 133706202-133706285 [+]
rno-mir-665chr6: 133706457-133706550 [+]
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-434-1chr6: 133715378-133715458 [+]
rno-mir-3543-2chr6: 133716215-133716329 [-]
rno-mir-434-2chr6: 133716248-133716328 [+]
rno-mir-136chr6: 133716761-133716842 [+]
Database links

Mature sequence rno-miR-434-5p

Accession MIMAT0017307
Previous IDsrno-miR-434*
Sequence

12 - 

agcucgacucaugguuugaacca

 - 34

Get sequence
Deep sequencing476028 reads, 426 experiments
Evidence experimental; SOLiD [2]

Mature sequence rno-miR-434-3p

Accession MIMAT0005315
Previous IDsrno-miR-434
Sequence

50 - 

uuugaaccaucacucgacuccu

 - 71

Get sequence
Deep sequencing10066396 reads, 486 experiments
Evidence experimental; cloned [1], SOLiD [2]

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).