Stem-loop sequence rno-mir-425

AccessionMI0006146 (change log)
DescriptionRattus norvegicus miR-425 stem-loop
Gene family MIPF0000242; mir-425
Literature search

4 open access papers mention rno-mir-425
(7 sentences)

Stem-loop
   --  u  u    aau        cac     u  ----ag   g 
5'   ag gc uugg   gacacgau   ucccg ug      ugg c
     || || ||||   ||||||||   ||||| ||      |||  
3'   uc cg gacc   cugugcua   agggc ac      acc a
   uu  u  u    cgc        -ua     u  cgaaga   c 
Get sequence
Deep sequencing
260575 reads, 178 reads per million, 497 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 117354821-117354903 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-425
rno-mir-191bchr8: 117354348-117354467 [-]
rno-mir-191achr8: 117354364-117354454 [+]
rno-mir-425chr8: 117354821-117354903 [+]
Database links

Mature sequence rno-miR-425-5p

Accession MIMAT0005314
Previous IDsrno-miR-425
Sequence

11 - 

aaugacacgaucacucccguuga

 - 33

Get sequence
Deep sequencing244997 reads, 497 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-425-3p

Accession MIMAT0017306
Previous IDsrno-miR-425*
Sequence

52 - 

aucgggaauaucguguccgcc

 - 72

Get sequence
Deep sequencing15572 reads, 481 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).