Stem-loop sequence rno-mir-423

AccessionMI0006145 (change log)
DescriptionRattus norvegicus miR-423 stem-loop
Gene family MIPF0000329; mir-423
Literature search

13 open access papers mention rno-mir-423
(122 sentences)

Stem-loop
   --     u            -ag   g    a     cua 
5'   gaagu aggcugaggggc   aga cgag cuuuu   u
     ||||| ||||||||||||   ||| |||| |||||   u
3'   cuucg ucugacuccccg   ucu gcuc gaaaa   u
   uc     u            gag   g    -     ccu 
Get sequence
Deep sequencing
536420 reads, 337 reads per million, 505 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 63098366-63098444 [+]
sense
ENSRNOT00000030749 ; Nsrp1-201; intron 1
ENSRNOT00000053660 ; Mir423-201; exon 1
Database links

Mature sequence rno-miR-423-5p

Accession MIMAT0017305
Previous IDsrno-miR-423*
Sequence

11 - 

ugaggggcagagagcgagacuuuu

 - 34

Get sequence
Deep sequencing213443 reads, 501 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-423-3p

Accession MIMAT0005313
Previous IDsrno-miR-423
Sequence

47 - 

agcucggucugaggccccucagu

 - 69

Get sequence
Deep sequencing322974 reads, 500 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).