Stem-loop sequence rno-mir-410

AccessionMI0006143 (change log)
DescriptionRattus norvegicus miR-410 stem-loop
Gene family MIPF0000018; mir-154
Literature search

9 open access papers mention rno-mir-410
(97 sentences)

Stem-loop
   --ac       g    ug      a  a     - uuu 
5'     uugagga aggu  ucugug ug guucg c   a
       ||||||| ||||  |||||| || ||||| |   u
3'     aacuuuu uccg  agacac au uaagc g   u
   ccau       g    gu      a  a     a uaa 
Get sequence
Deep sequencing
741197 reads, 486 reads per million, 474 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133893997-133894072 [+]
sense
ENSRNOT00000053680 ; Mir410-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-410
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-410chr6: 133893997-133894072 [+]
rno-mir-3072chr6: 133898795-133898905 [+]
Database links

Mature sequence rno-miR-410-5p

Accession MIMAT0017303
Previous IDsrno-miR-410*
Sequence

11 - 

agguugucugugaugaguucg

 - 31

Get sequence
Deep sequencing191 reads, 72 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-410-3p

Accession MIMAT0005311
Previous IDsrno-miR-410
Sequence

46 - 

aauauaacacagauggccugu

 - 66

Get sequence
Deep sequencing741004 reads, 474 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).