Stem-loop sequence rno-mir-384

AccessionMI0006142 (change log)
DescriptionRattus norvegicus miR-384 stem-loop
Gene family MIPF0000289; mir-384
Literature search

9 open access papers mention rno-mir-384
(27 sentences)

Stem-loop
   --aau    a     a       c     c    -ug   aa 
5'      cagg auugu aacaauu cuagg aaug   uau  u
        |||| ||||| ||||||| ||||| ||||   |||  g
3'      gucc uaaca uuguuaa gaucc uuac   aug  u
   acaau    g     c       a     -    uga   gu 
Get sequence
Deep sequencing
202370 reads, 118 reads per million, 410 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 76301763-76301845 [-]
sense
ENSRNOT00000053678 ; Mir384-201; exon 1
Database links

Mature sequence rno-miR-384-5p

Accession MIMAT0005309
Sequence

11 - 

uguaaacaauuccuaggcaaugu

 - 33

Get sequence
Deep sequencing111962 reads, 383 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-384-3p

Accession MIMAT0005310
Sequence

52 - 

auuccuagaaauuguucacaau

 - 73

Get sequence
Deep sequencing90372 reads, 373 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).