Stem-loop sequence rno-mir-380

AccessionMI0006141 (change log)
DescriptionRattus norvegicus miR-380 stem-loop
Gene family MIPF0000126; mir-379
Literature search

6 open access papers mention rno-mir-380
(8 sentences)

Stem-loop
   --acc   a      guu       ga       c   u 
5'      uga aagaug   gaccaua  acaugcg uac u
        ||| ||||||   |||||||  ||||||| |||  
3'      acu uucuac   cugguau  uguaugc gug c
   cuauu   c      -ac       ga       u   u 
Get sequence
Deep sequencing
78467 reads, 69.9 reads per million, 359 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133860490-133860566 [+]
antisense
ENSRNOT00000053596 ; Mir3579-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-380
rno-mir-379chr6: 133857700-133857784 [+]
rno-mir-411chr6: 133858849-133858924 [+]
rno-mir-299bchr6: 133859295-133859412 [-]
rno-mir-299achr6: 133859324-133859386 [+]
rno-mir-3579chr6: 133860473-133860585 [-]
rno-mir-380chr6: 133860490-133860566 [+]
rno-mir-323chr6: 133861199-133861284 [+]
rno-mir-758chr6: 133861498-133861575 [+]
rno-mir-329chr6: 133862168-133862264 [+]
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
Database links

Mature sequence rno-miR-380-5p

Accession MIMAT0005308
Previous IDsrno-miR-380
Sequence

11 - 

augguugaccauagaacaugcg

 - 32

Get sequence
Deep sequencing3030 reads, 188 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-380-3p

Accession MIMAT0017302
Previous IDsrno-miR-380*
Sequence

47 - 

uauguaguaugguccacaucu

 - 67

Get sequence
Deep sequencing75417 reads, 357 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).