Stem-loop sequence rno-mir-375

AccessionMI0006140 (change log)
DescriptionRattus norvegicus miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

37 open access papers mention rno-mir-375
(232 sentences)

Stem-loop
   --   g   c    a      ccu  c     c  gac 
5'   ucc gcc cgcg cgagcc   cg acaaa cg   c
     ||| ||| |||| ||||||   || ||||| ||    
3'   ggg cgg gugc gcucgg   gc uguuu gc   u
   cg   a   a    -      cuu  u     u  gag 
Get sequence
Deep sequencing
2902102 reads, 3.19e+03 reads per million, 491 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr9: 82161716-82161790 [-]
intergenic
Database links

Mature sequence rno-miR-375-5p

Accession MIMAT0017301
Previous IDsrno-miR-375*
Sequence

10 - 

gcgacgagccccucgcacaaacc

 - 32

Get sequence
Deep sequencing67 reads, 47 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-375-3p

Accession MIMAT0005307
Previous IDsrno-miR-375
Sequence

45 - 

uuuguucguucggcucgcguga

 - 66

Get sequence
Deep sequencing2902024 reads, 491 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).