Stem-loop sequence rno-mir-196c

AccessionMI0006136 (change log)
DescriptionRattus norvegicus miR-196c stem-loop
Gene family MIPF0000031; mir-196
Literature search

9 open access papers mention rno-mir-196c
(16 sentences)

Stem-loop
   -   -      g     a    c         - gc ugg 
5'  cug agugaa uaggu guuu guguuguug g  c   c
    ||| |||||| ||||| |||| ||||||||| |  |   u
3'  gac ucacuu gucca caaa cacaacaac c  g   u
   u   g      a     c    c         a aa ucu 
Get sequence
Deep sequencing
228907 reads, 168 reads per million, 399 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 84113578-84113657 [+]
intergenic
Database links

Mature sequence rno-miR-196c-5p

Accession MIMAT0005303
Previous IDsrno-miR-196c
Sequence

11 - 

uagguaguuucguguuguuggg

 - 32

Get sequence
Deep sequencing226855 reads, 398 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-196c-3p

Accession MIMAT0017299
Previous IDsrno-miR-196c*
Sequence

48 - 

acaacaacaccaaaccaccuga

 - 69

Get sequence
Deep sequencing2044 reads, 132 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).