Stem-loop sequence rno-mir-190b

AccessionMI0006135 (change log)
DescriptionRattus norvegicus miR-190b stem-loop
Gene family MIPF0000076; mir-190
Literature search

6 open access papers mention rno-mir-190b
(6 sentences)

Stem-loop
   --u   u     u  u            a     -  aaa 
5'    gcu cugug ga auguuugauauu gguug uu   u
      ||| ||||| || |||||||||||| ||||| ||    
3'    uga gacac cu uacaaacuguaa ucaac aa   u
   gag   c     u  -            a     c  gua 
Get sequence
Deep sequencing
12312 reads, 0 reads per million, 450 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 189421137-189421214 [+]
intergenic
Database links

Mature sequence rno-miR-190b-5p

Accession MIMAT0005302
Previous IDsrno-miR-190b
Sequence

11 - 

ugauauguuugauauuagguu

 - 31

Get sequence
Deep sequencing12300 reads, 450 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-190b-3p

Accession MIMAT0017298
Previous IDsrno-miR-190b*
Sequence

47 - 

aacuaaaugucaaacauucu

 - 66

Get sequence
Deep sequencing11 reads, 11 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).