Stem-loop sequence rno-mir-182

AccessionMI0006133 (change log)
DescriptionRattus norvegicus miR-182 stem-loop
Gene family MIPF0000116; mir-182
Literature search

34 open access papers mention rno-mir-182
(302 sentences)

Stem-loop
   -----ac c    -   g --          cuc 
5'        g gggu cua c  ugccggaggc   c
          | |||| ||| |  ||||||||||    
3'        c cuca gau g  acgguuuuug   c
   auggcca a    a   g ua          cca 
Get sequence
Deep sequencing
4132788 reads, 4.65e+03 reads per million, 508 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 57459773-57459834 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-182
rno-mir-3553chr4: 57463572-57463677 [+]
rno-mir-183chr4: 57463569-57463678 [-]
rno-mir-96chr4: 57463366-57463471 [-]
rno-mir-182chr4: 57459773-57459834 [-]
Database links

Mature sequence rno-miR-182

Accession MIMAT0005300
Sequence

35 - 

uuuggcaaugguagaacucacaccg

 - 59

Get sequence
Deep sequencing4132787 reads, 508 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).