Stem-loop sequence rno-mir-181d

AccessionMI0006132 (change log)
DescriptionRattus norvegicus miR-181d stem-loop
Gene family MIPF0000007; mir-181
Literature search

25 open access papers mention rno-mir-181d
(46 sentences)

Stem-loop
   ---       auua         g ug          guga  ag 
5'    ggucaca    acauucauu u  ucgguggguu    gg  a
      |||||||    ||||||||| |  ||||||||||    ||   
3'    ucggugu    uguaaguag g  ggccacccag    cc  a
   ggg       -cac         g --          ---a  ag 
Get sequence
Deep sequencing
2625004 reads, 1.83e+03 reads per million, 508 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr19: 25290051-25290133 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-181d
rno-mir-181cchr19: 25290211-25290316 [-]
rno-mir-181dchr19: 25290051-25290133 [-]
Database links

Mature sequence rno-miR-181d-5p

Accession MIMAT0005299
Previous IDsrno-miR-181d
Sequence

11 - 

aacauucauuguugucggugggu

 - 33

Get sequence
Deep sequencing2624827 reads, 508 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-181d-3p

Accession MIMAT0017296
Previous IDsrno-miR-181d*
Sequence

53 - 

ccaccgggggaugaauguca

 - 72

Get sequence
Deep sequencing173 reads, 110 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).