Stem-loop sequence rno-mir-17-2

AccessionMI0006131 (change log)
DescriptionRattus norvegicus miR-17-2 stem-loop
Gene family MIPF0000001; mir-17
Literature search

72 open access papers mention rno-mir-17-2
(563 sentences)

Stem-loop
   -u   cc    -ca        a        g   cu  u 
5'   ugg  augu   aagugcuu cagugcag uag  uc u
     |||  ||||   |||||||| |||||||| |||  ||  
3'   acc  uaca   uucacgaa gucacguc auc  ag g
   gu   au    uuc        c        -   -u  a 
Get sequence
Deep sequencing
96856 reads, 38.6 reads per million, 492 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 140117891-140117968 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-17-2
rno-mir-17-2chrX: 140117891-140117968 [-]
rno-mir-20bchrX: 140117518-140117589 [-]
rno-mir-19b-2chrX: 140117379-140117474 [-]
rno-mir-92a-2chrX: 140117249-140117340 [-]
rno-mir-363chrX: 140117098-140117184 [-]
Database links

Mature sequence rno-miR-17-5p

Accession MIMAT0000786
Previous IDsrno-miR-17
Sequence

11 - 

caaagugcuuacagugcagguag

 - 33

Get sequence
Deep sequencing192321 reads, 492 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-17-2-3p

Accession MIMAT0017295
Sequence

47 - 

acugcacugcaagcacuucuuac

 - 69

Get sequence
Deep sequencing648 reads, 192 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).