Stem-loop sequence rno-mir-147

AccessionMI0006130 (change log)
DescriptionRattus norvegicus miR-147 stem-loop
Gene family MIPF0000105; mir-147
Literature search

3 open access papers mention rno-mir-147
(23 sentences)

Stem-loop
   --  u    c   ug   a  c         ---aac   a 
5'   ua gaau uag  gaa ca uucugcaca      ucg u
     || |||| |||  ||| || |||||||||      |||  
3'   au uuua auc  cuu gu aaggcgugu      agu u
   gg  u    c   gu   c  a         gaccgu   u 
Get sequence
Deep sequencing
10958 reads, 1.26 reads per million, 398 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 114775343-114775421 [+]
sense
ENSRNOT00000073569 ; MGC105649-201; exon 5
Database links

Mature sequence rno-miR-147

Accession MIMAT0005297
Sequence

48 - 

gugugcggaaaugcuucugcua

 - 69

Get sequence
Deep sequencing10783 reads, 398 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).