Stem-loop sequence mmu-mir-467e

AccessionMI0006128 (change log)
Symbol MGI:Mir467e
DescriptionMus musculus miR-467e stem-loop
Gene family MIPF0000316; mir-467
Literature search

21 open access papers mention mmu-mir-467e
(67 sentences)

Stem-loop
   --gc          --------aa     a c             ua 
5'     cugugugcau          gugug g auguauaugugug  u
       ||||||||||          ||||| | |||||||||||||  a
3'     gacacacgua          cacac c uacauauacguau  u
   uaca          cacauauauc     a a             uu 
Get sequence
Deep sequencing
31424 reads, 128 reads per million, 104 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10505721-10505807 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-467e
mmu-mir-467a-8chr2: 10495980-10496062 [+]
mmu-mir-466b-7chr2: 10496268-10496355 [+]
mmu-mir-669p-2chr2: 10496497-10496583 [+]
mmu-mir-467a-9chr2: 10498393-10498475 [+]
mmu-mir-466b-2chr2: 10498685-10498766 [+]
mmu-mir-669a-10chr2: 10498911-10498997 [+]
mmu-mir-669a-11chr2: 10501339-10501425 [+]
mmu-mir-467a-10chr2: 10503273-10503355 [+]
mmu-mir-466b-3chr2: 10503565-10503645 [+]
mmu-mir-669a-12chr2: 10503791-10503877 [+]
mmu-mir-467echr2: 10505721-10505807 [+]
mmu-mir-466pchr2: 10506006-10506094 [+]
mmu-mir-467dchr2: 10507630-10507714 [+]
mmu-mir-466achr2: 10507918-10507990 [+]
mmu-mir-297cchr2: 10509016-10509113 [+]
mmu-mir-669cchr2: 10509296-10509404 [+]
mmu-mir-669a-2chr2: 10510164-10510260 [+]
mmu-mir-297bchr2: 10511667-10511775 [+]
mmu-mir-466dchr2: 10511967-10512062 [+]
mmu-mir-669m-1chr2: 10512790-10512887 [+]
mmu-mir-669m-2chr2: 10513434-10513531 [+]
mmu-mir-466nchr2: 10513741-10513834 [+]
mmu-mir-669ochr2: 10514300-10514395 [+]
mmu-mir-466gchr2: 10514595-10514674 [+]
mmu-mir-466hchr2: 10514891-10514971 [+]
Database links

Mature sequence mmu-miR-467e-5p

Accession MIMAT0005293
Previous IDsmmu-miR-467e
Sequence

11 - 

auaagugugagcauguauaugu

 - 32

Get sequence
Deep sequencing16041 reads, 102 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-467e-3p

Accession MIMAT0005294
Previous IDsmmu-miR-467e*
Sequence

48 - 

auauacauacacacaccuauau

 - 69

Get sequence
Deep sequencing15358 reads, 97 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).