Stem-loop sequence mmu-mir-582

AccessionMI0006127 (change log)
Symbol MGI:Mir582
DescriptionMus musculus miR-582 stem-loop
Gene family MIPF0000417; mir-582
Literature search

9 open access papers mention mmu-mir-582
(38 sentences)

Stem-loop
   -----         aua            ca     uaaucu 
5'      acucuuugg   caguuguucaac  guuac      a
        |||||||||   ||||||||||||  |||||       
3'      ugggaaacc   gucaacaaguug  caaug      a
   aaacg         caa            uc     uuaauc 
Get sequence
Deep sequencing
15731 reads, 15.5 reads per million, 84 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 109324744-109324824 [+]
sense
OTTMUST00000080696 ; Pde4d-006; intron 1
OTTMUST00000080694 ; Pde4d-004; intron 1
OTTMUST00000080693 ; Pde4d-003; intron 1
OTTMUST00000080695 ; Pde4d-005; intron 1
OTTMUST00000079296 ; Pde4d-001; intron 3
ENSMUST00000129374 ; Pde4d-006; intron 1
ENSMUST00000138938 ; Pde4d-004; intron 1
ENSMUST00000120671 ; Pde4d-003; intron 1
ENSMUST00000153234 ; Pde4d-005; intron 1
ENSMUST00000177907 ; Pde4d-201; intron 2
ENSMUST00000122041 ; Pde4d-001; intron 3
Database links

Mature sequence mmu-miR-582-5p

Accession MIMAT0005291
Sequence

10 - 

auacaguuguucaaccaguuac

 - 31

Get sequence
Deep sequencing5429 reads, 75 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-582-3p

Accession MIMAT0005292
Sequence

47 - 

uaaccuguugaacaacugaac

 - 67

Get sequence
Deep sequencing10302 reads, 69 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).