Stem-loop sequence rno-mir-883

AccessionMI0006126 (change log)
DescriptionRattus norvegicus miR-883 stem-loop
Gene family MIPF0000389; mir-883
Literature search

3 open access papers mention rno-mir-883
(4 sentences)

Stem-loop
   -u  -acu             a  a          uuu 
5'   gc    caaugcugagaga gu gcaguuacuu   a
     ||    ||||||||||||| || ||||||||||   c
3'   cg    guuaugacucucu ca cgucaaugaa   u
   cu  gaau             a  a          uuc 
Get sequence
Deep sequencing
1395 reads, 85.4 reads per million, 41 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 151260703-151260779 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-883
rno-mir-883chrX: 151260703-151260779 [-]
rno-mir-742chrX: 151260313-151260389 [-]
rno-mir-743bchrX: 151253318-151253394 [-]
rno-mir-743achrX: 151252828-151252903 [-]
Database links

Mature sequence rno-miR-883-5p

Accession MIMAT0017294
Previous IDsrno-miR-883*
Sequence

10 - 

ugcugagagaaguagcaguuacu

 - 32

Get sequence
Deep sequencing200 reads, 20 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-883-3p

Accession MIMAT0005290
Previous IDsrno-miR-883
Sequence

46 - 

uaacugcaacaucucucaguau

 - 67

Get sequence
Deep sequencing1195 reads, 40 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).