Stem-loop sequence rno-mir-881

AccessionMI0006123 (change log)
DescriptionRattus norvegicus miR-881 stem-loop
Gene family MIPF0000429; mir-881
Literature search

2 open access papers mention rno-mir-881
(3 sentences)

Stem-loop
   --u   g   aa         ug  a     c        
5'    gca uac  uauucagag  gu gcagu acuuuau 
      ||| |||  |||||||||  || ||||| |||||| u
3'    ugu aug  auaagucuu  cg uguca ugaaauc 
   acu   a   ag         ua  g     a        
Get sequence
Deep sequencing
26329 reads, 590 reads per million, 126 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 151283910-151283986 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-881
rno-mir-871chrX: 151287787-151287863 [-]
rno-mir-881chrX: 151283910-151283986 [-]
rno-mir-878chrX: 151283461-151283537 [-]
rno-mir-880chrX: 151281988-151282065 [-]
rno-mir-463chrX: 151276029-151276106 [-]
rno-mir-741chrX: 151274356-151274451 [-]
Database links

Mature sequence rno-miR-881-5p

Accession MIMAT0017293
Previous IDsrno-miR-881*
Sequence

11 - 

uauucagagugguagcagu

 - 29

Get sequence
Deep sequencing241 reads, 23 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-881-3p

Accession MIMAT0005289
Previous IDsrno-miR-881
Sequence

45 - 

uaacuguggcauuucugaauag

 - 66

Get sequence
Deep sequencing26087 reads, 123 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).