Stem-loop sequence rno-mir-874

AccessionMI0006118 (change log)
DescriptionRattus norvegicus miR-874 stem-loop
Gene family MIPF0000401; mir-874
Literature search

11 open access papers mention rno-mir-874
(20 sentences)

Stem-loop
   --      cug   c   a  ca        a ag  a 
5'   uuagcc   cgg ccc cg  ccagggua g  ag c
     ||||||   ||| ||| ||  |||||||| |  || u
3'   ggucgg   gcc ggg gc  ggucccgu c  uc c
   cg      uca   a   a  cc        - cu  g 
Get sequence
Deep sequencing
25363 reads, 1.83 reads per million, 437 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 7025014-7025089 [+]
sense
ENSRNOT00000034877 ; Klhl3-201; intron 8
Database links

Mature sequence rno-miR-874-5p

Accession MIMAT0017290
Previous IDsrno-miR-874*
Sequence

10 - 

cggccccacgcaccaggguaa

 - 30

Get sequence
Deep sequencing3742 reads, 322 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-874-3p

Accession MIMAT0005284
Previous IDsrno-miR-874
Sequence

45 - 

cugcccuggcccgagggaccga

 - 66

Get sequence
Deep sequencing21620 reads, 427 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).