Stem-loop sequence rno-mir-872

AccessionMI0006117 (change log)
DescriptionRattus norvegicus miR-872 stem-loop
Gene family MIPF0000399; mir-872
Literature search

7 open access papers mention rno-mir-872
(25 sentences)

Stem-loop
   --    u     a        u  --         accucau 
5'   aacu guuag agguuacu gu  uaguucagg       u
     |||| ||||| |||||||| ||  |||||||||        
3'   uugg caauc uccgauga cg  aucaagucc       a
   ua    u     c        -  uu         gucuuuc 
Get sequence
Deep sequencing
289064 reads, 216 reads per million, 499 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 113657727-113657807 [+]
sense
ENSRNOT00000011336 ; Ift74-201; intron 13
Database links

Mature sequence rno-miR-872-5p

Accession MIMAT0005282
Previous IDsrno-miR-872
Sequence

11 - 

aagguuacuuguuaguucagg

 - 31

Get sequence
Deep sequencing202565 reads, 499 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-872-3p

Accession MIMAT0005283
Previous IDsrno-miR-872*
Sequence

50 - 

ugaacuauugcaguagccuccu

 - 71

Get sequence
Deep sequencing86493 reads, 491 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).