Stem-loop sequence rno-mir-871

AccessionMI0006116 (change log)
DescriptionRattus norvegicus miR-871 stem-loop
Gene family MIPF0000386; mir-743
Literature search

1 open access papers mention rno-mir-871
(3 sentences)

Stem-loop
   --u   g   cc       au            c   a 
5'    gca ugc  uauucag  uggugccgguca aug a
      ||| |||  |||||||  |||||||||||| ||| g
3'    cgu aug  auagguc  accacggucagu uac u
   acu   a   ua       au            a   a 
Get sequence
Deep sequencing
17198 reads, 337 reads per million, 123 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 151287787-151287863 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-871
rno-mir-465chrX: 151297367-151297443 [-]
rno-mir-3580chrX: 151295615-151295695 [-]
rno-mir-871chrX: 151287787-151287863 [-]
rno-mir-881chrX: 151283910-151283986 [-]
rno-mir-878chrX: 151283461-151283537 [-]
rno-mir-880chrX: 151281988-151282065 [-]
Database links

Mature sequence rno-miR-871-5p

Accession MIMAT0005281
Previous IDsrno-miR-871
Sequence

11 - 

uauucagauuggugccggucacau

 - 34

Get sequence
Deep sequencing6099 reads, 88 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-871-3p

Accession MIMAT0017289
Previous IDsrno-miR-871*
Sequence

45 - 

ugacuggcaccauacuggauaa

 - 66

Get sequence
Deep sequencing11099 reads, 99 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).