Stem-loop sequence rno-mir-466c

AccessionMI0006114 (change log)
DescriptionRattus norvegicus miR-466c stem-loop
Gene family MIPF0000316; mir-467
Literature search

14 open access papers mention rno-mir-466c
(92 sentences)

Stem-loop
   caugug   au   a           aca            aa 
5'       ugu  gug uguguguaugu   uguguguauaug  g
         |||  ||| |||||||||||   ||||||||||||   
3'       acg  cac acacacauaca   acguacauauac  a
   ------   gu   -           --c            aa 
Get sequence
Deep sequencing
7506 reads, 0.461 reads per million, 434 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 72060077-72060155 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-466c
rno-mir-466b-3chr17: 72069566-72069651 [-]
rno-mir-466b-4chr17: 72066536-72066617 [-]
rno-mir-466cchr17: 72060077-72060155 [-]
Database links

Mature sequence rno-miR-466c-5p

Accession MIMAT0005279
Previous IDsrno-miR-466c
Sequence

11 - 

ugugauguguguauguacaug

 - 31

Get sequence
Deep sequencing4549 reads, 399 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-466c-3p

Accession MIMAT0017287
Previous IDsrno-miR-466c*
Sequence

50 - 

uauacaugcacacauacacac

 - 70

Get sequence
Deep sequencing2936 reads, 346 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).