Stem-loop sequence smo-MIR396

AccessionMI0006060 (change log)
DescriptionSelaginella moellendorffii miR396 stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
   ---uc    gc                     c g        ccaaggcaggaggaucagaaaacguugugguauuucucauc 
5'      ucau  uuuuccacggcuuucuugaac u gugcucuu                                         u
        ||||  ||||||||||||||||||||| | ||||||||                                         c
3'      ggua  aaagggugucgaaagaacuug a caugagaa                                         c
   aggcc    ac                     a g        ugaccacucaaagaaaguuccccucugguuccugcucugcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence smo-miR396

Accession MIMAT0005227
Sequence

11 - 

uuccacggcuuucuugaacc

 - 30

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).