Stem-loop sequence ppt-MIR1023c

AccessionMI0005962 (change log)
DescriptionPhyscomitrella patens miR1023c stem-loop
Gene family MIPF0000396; MIR1023
Stem-loop
   --gcg      cac        u    g   c      c    u      u  c ug u  cuagcc           c      uu 
5'      caguua   agcuugca uucg ugu cacucu uccg uucccu cc a  a gg      uugaguaagua auaugu  u
        ||||||   |||||||| |||| ||| |||||| |||| |||||| || |  | ||      ||||||||||| ||||||  g
3'      guuagu   ucgaacgu aagu aca gugaga aggc aaggga gg u  u cc      aauucguucgu uguaca  a
   gcuua      ---        u    a   u      a    u      -  c gu u  ---uaa           a      ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr10: 3231102-3231269 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR1023c
ppt-MIR1023eChr10: 3221227-3221346 [-]
ppt-MIR1023cChr10: 3231102-3231269 [+]
Database links

Mature sequence ppt-miR1023c-5p

Accession MIMAT0005106
Sequence

30 - 

ccacucucuccguuucccuucc

 - 51

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR1023c-3p

Accession MIMAT0005107
Sequence

122 - 

agggaaucggaaagaguguac

 - 142

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).