Stem-loop sequence ppt-MIR529g

AccessionMI0005927 (change log)
DescriptionPhyscomitrella patens miR529g stem-loop
Gene family MIPF0000388; MIR529
Literature search

2 open access papers mention ppt-MIR529g
(3 sentences)

Stem-loop
   ucaccuuuuuc       a  cu   gu c            c       -cag   u      -cac   c  u 
5'            uacauuc ag  ggg  u gaagagagagag acagucc    acu uucacu    gac ac u
              ||||||| ||  |||  | |||||||||||| |||||||    ||| ||||||    ||| || u
3'            guguaag uc  ccc  a cuuuucucucuc ugucggg    uga aagugg    cug ug g
   -cgcuaucuuu       c  au   ug c            a       cuga   c      uauu   -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr24: 1643642-1643790 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR529g
ppt-MIR529fChr24: 1643882-1644003 [-]
ppt-MIR529gChr24: 1643642-1643790 [-]
Database links

Mature sequence ppt-miR529g

Accession MIMAT0005060
Sequence

30 - 

cgaagagagagagcacagucc

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).