Stem-loop sequence ppt-MIR529f

AccessionMI0005926 (change log)
DescriptionPhyscomitrella patens miR529f stem-loop
Gene family MIPF0000388; MIR529
Literature search

2 open access papers mention ppt-MIR529f
(3 sentences)

Stem-loop
   ugcacaauuuucu      u c      c                     aacgg     g 
5'              cacuca g ugggau agaagagagagaguacagccc     ccgau u
                |||||| | |||||| |||||||||||||||||||||     ||||| u
3'              gugggu c accuug ucuucucucucucgugucggg     gguug c
   -ucuugccuuuac      c a      u                     --caa     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr24: 1643882-1644003 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR529f
ppt-MIR529fChr24: 1643882-1644003 [-]
ppt-MIR529gChr24: 1643642-1643790 [-]
Database links

Mature sequence ppt-miR529f

Accession MIMAT0005059
Sequence

30 - 

agaagagagagaguacagccc

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).