Stem-loop sequence ppt-MIR529e

AccessionMI0005925 (change log)
DescriptionPhyscomitrella patens miR529e stem-loop
Gene family MIPF0000388; MIR529
Literature search

2 open access papers mention ppt-MIR529e
(3 sentences)

Stem-loop
   uca     uu  --u      u c                             agag    cg 
5'    gcaau  ac   cacuca g ugggaucagaagagagagaguacagccca    caac  c
      |||||  ||   |||||| | |||||||||||||||||||||||||||||    ||||   
3'    uguug  ug   gugagu c accuuggucuucucucucucgugucgggu    guug  u
   ---     gc  uac      c a                             -aag    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr23: 8765009-8765130 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR529e
ppt-MIR529eChr23: 8765009-8765130 [-]
ppt-MIR529aChr23: 8764781-8764929 [-]
Database links

Mature sequence ppt-miR529e

Accession MIMAT0005058
Sequence

30 - 

agaagagagagaguacagccc

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).