Stem-loop sequence ppt-MIR529d

AccessionMI0005924 (change log)
DescriptionPhyscomitrella patens miR529d stem-loop
Gene family MIPF0000388; MIR529
Literature search

2 open access papers mention ppt-MIR529d
(3 sentences)

Stem-loop
   cuagcuucuccacaauuucucacccuc     ga c                      -a  u  aau 
5'                            guugg  u agaagagagagagcacagcccg  ug cc   g
                              |||||  | ||||||||||||||||||||||  || ||    
3'                            caacc  g ucuucucucucucgugucgggu  gc gg   u
   -caugggaucuacgcacaucguggguu     uc u                      aa  u  acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr20: 13887655-13887790 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR529d
ppt-MIR529dChr20: 13887655-13887790 [+]
ppt-MIR529bChr20: 13887884-13888032 [+]
Database links

Mature sequence ppt-miR529d

Accession MIMAT0005057
Sequence

37 - 

agaagagagagagcacagccc

 - 57

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).