Stem-loop sequence ppt-MIR529b

AccessionMI0005922 (change log)
DescriptionPhyscomitrella patens miR529b stem-loop
Gene family MIPF0000388; MIR529
Literature search

2 open access papers mention ppt-MIR529b
(3 sentences)

Stem-loop
   -uuca c  u  u   c  a  cc      c                     -  a -uu  a    -a      u 
5'      g cg ac aca cc ag  gggauu gaagagagagagcacagcccg ua c   uc cuaa  gaccac u
        | || || ||| || ||  |||||| ||||||||||||||||||||| || |   || ||||  |||||| a
3'      c gc ug ugu gg uc  cccuga cuuuucucucucgugucgggc gu g   ag gguu  uuggug u
   cacua c  -  -   a  c  au      c                     u  a uuu  a    ac      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr20: 13887884-13888032 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR529b
ppt-MIR529dChr20: 13887655-13887790 [+]
ppt-MIR529bChr20: 13887884-13888032 [+]
Database links

Mature sequence ppt-miR529b

Accession MIMAT0005055
Sequence

30 - 

cgaagagagagagcacagccc

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).