Stem-loop sequence cel-mir-1022

AccessionMI0005900 (change log)
DescriptionCaenorhabditis elegans miR-1022 stem-loop
Stem-loop
       caaaau    aa      ug  a    -gc      gaag 
5' gguc      cggc  gaucau  uu ggac   caucuu    c
   ||||      ||||  ||||||  || ||||   ||||||    a
3' ucgg      gucg  cuagua  aa ccug   guagaa    a
       -aacuu    ac      gu  -    aua      auau 
Get sequence
Deep sequencing
46390 reads, 144 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 6435425-6435512 [-]
intergenic
Database links

Mature sequence cel-miR-1022-5p

Accession MIMAT0005523
Previous IDscel-miR-1022
Sequence

15 - 

aagaucauuguuaggacgccauc

 - 37

Get sequence
Deep sequencing46359 reads, 16 experiments
Evidence experimental; cloned [1], Illumina [2,4], CLIPseq [3]
Database links
Predicted targets

Mature sequence cel-miR-1022-3p

Accession MIMAT0020357
Previous IDscel-miR-1022*
Sequence

54 - 

augauaguccaaugaugauccagc

 - 77

Get sequence
Deep sequencing31 reads, 1 experiments
Evidence experimental; Illumina [4]

References

1
PMID:17652138 "Distinct ribonucleoprotein reservoirs for microRNA and siRNA populations in C. elegans" Gu SG, Pak J, Barberan-Soler S, Ali M, Fire A, Zahler AM RNA. 13:1492-1504(2007).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
4