Stem-loop sequence cel-mir-1021

AccessionMI0005899 (change log)
DescriptionCaenorhabditis elegans miR-1021 stem-loop
Stem-loop
           u           -gauc       --------aucc       u 
5' uacuguuu gaaacaaguga     augugaa            ucggagc c
   |||||||| |||||||||||     |||||||            ||||||| g
3' augacaaa cuuuguuuauu     uauacuu            aguuucg g
           -           aaauu       auaaaccuuuua       a 
Get sequence
Deep sequencing
17 reads, 1.86e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 16473085-16473181 [-]
intergenic
Database links

Mature sequence cel-miR-1021

Accession MIMAT0005522
Sequence

15 - 

aagugagaucaugugaaauccucgg

 - 39

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17652138 "Distinct ribonucleoprotein reservoirs for microRNA and siRNA populations in C. elegans" Gu SG, Pak J, Barberan-Soler S, Ali M, Fire A, Zahler AM RNA. 13:1492-1504(2007).