|
miRBase |
|
Stem-loop sequence mdv2-mir-M27 |
|
| Accession | MI0005895 |
| Description | Mareks disease virus type 2 miR-M27 stem-loop |
| Stem-loop |
c - uc g - ug g u ucc uccuuc g cgguguucga gc g a ac u ||| |||||| | |||||||||| || | | || agg aggagg c gccacgagcu cg c u ug u a u gu g c gu a u |
Mature sequence mdv2-miR-M27-5p |
|
| Accession | MIMAT0004472 |
| Sequence |
7 - cuucguccgguguucgaggcg - 27 |
| Evidence | experimental; cloned [1], Solexa [2] |
Mature sequence mdv2-miR-M27-3p |
|
| Accession | MIMAT0004473 |
| Sequence |
46 - gcgucgagcaccgugcuggagga - 68 |
| Evidence | experimental; cloned [1], Solexa [2] |
References |
|
| 1 |
PMID:17459919
"Marek's disease virus type 2 (MDV-2)-encoded microRNAs show no sequence conservation with those encoded by MDV-1"
J Virol. 81:7164-7170(2007).
|
| 2 |
PMID:19328516
"MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific"
Virology. 388:128-136(2009).
|