Stem-loop sequence mdv2-mir-M26

AccessionMI0005894 (change log)
DescriptionMareks disease virus type 2 miR-M26 stem-loop
Stem-loop
             -   u    g       ucg 
5' ccguccuuug ugc gugu ugagagg   u
   |||||||||| ||| |||| |||||||   c
3' gguaggaagc acg cacg gcucuuc   a
             c   c    g       ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdv2-miR-M26-5p

Accession MIMAT0004471
Previous IDsmdv2-miR-M26
Sequence

4 - 

uccuuugugcugugugugaga

 - 24

Get sequence
Evidence experimental; cloned [1], Illumina [2]

Mature sequence mdv2-miR-M26-3p

Accession MIMAT0012544
Previous IDsmdv2-miR-M26*
Sequence

40 - 

ucgggcaccgcaccgaaggaug

 - 61

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17459919 "Marek's disease virus type 2 (MDV-2)-encoded microRNAs show no sequence conservation with those encoded by MDV-1" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Sewer A, Zavolan M, Nair V J Virol. 81:7164-7170(2007).
2
PMID:19328516 "MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific" Waidner LA, Morgan RW, Anderson AS, Bernberg EL, Kamboj S, Garcia M, Riblet SM, Ouyang M, Isaacs GK, Markis M, Meyers BC, Green PJ, Burnside J Virology. 388:128-136(2009).