|
miRBase |
|
Stem-loop sequence mdv2-mir-M24 |
|
| Accession | MI0005892 |
| Description | Mareks disease virus type 2 miR-M24 stem-loop |
| Stem-loop |
u u gc gu au ccauuuuu cccu acggu cugac cgu u |||||||| |||| ||||| ||||| ||| gguagaaa ggga ugccg gauug gca u - c ua -- au |
Mature sequence mdv2-miR-M24-5p |
|
| Accession | MIMAT0012543 |
| Previous IDs | mdv2-miR-M24* |
| Sequence |
5 - uuuuucccuuacggugccugacg - 27 |
| Evidence | experimental; Solexa [2] |
Mature sequence mdv2-miR-M24-3p |
|
| Accession | MIMAT0004468 |
| Previous IDs | mdv2-miR-M24 |
| Sequence |
42 - uuagaugccgucagggaaagau - 63 |
| Evidence | experimental; cloned [1], Solexa [2] |
References |
|
| 1 |
PMID:17459919
"Marek's disease virus type 2 (MDV-2)-encoded microRNAs show no sequence conservation with those encoded by MDV-1"
J Virol. 81:7164-7170(2007).
|
| 2 |
PMID:19328516
"MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific"
Virology. 388:128-136(2009).
|