|
miRBase |
|
Stem-loop sequence mdv2-mir-M17 |
|
| Accession | MI0005885 |
| Description | Mareks disease virus type 2 miR-M17 stem-loop |
| Stem-loop |
--------- a u gucc gug ucgucc gucc ucccgg ccuagag u |||||| |||| |||||| ||||||| agcggg cagg agggcc ggaucuu c agcgcgcgc a c aaca gca |
Mature sequence mdv2-miR-M17-5p |
|
| Accession | MIMAT0004456 |
| Previous IDs | mdv2-miR-M17* |
| Sequence |
7 - aguccuucccggguccccuaga - 28 |
| Evidence | experimental; cloned [1], Solexa [2] |
Mature sequence mdv2-miR-M17-3p |
|
| Accession | MIMAT0004457 |
| Previous IDs | mdv2-miR-M17 |
| Sequence |
41 - uaggacaaccgggacggacagg - 62 |
| Evidence | experimental; cloned [1], Solexa [2] |
References |
|
| 1 |
PMID:17459919
"Marek's disease virus type 2 (MDV-2)-encoded microRNAs show no sequence conservation with those encoded by MDV-1"
J Virol. 81:7164-7170(2007).
|
| 2 |
PMID:19328516
"MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific"
Virology. 388:128-136(2009).
|