Stem-loop sequence cel-mir-1020

AccessionMI0005881 (change log)
DescriptionCaenorhabditis elegans miR-1020 stem-loop
Stem-loop
   -- u                 cuuagacaaaacaa 
5'   g aaguguuacagaauaau              c
     | |||||||||||||||||               
3'   c uucacagugucuuauua              u
   ga u                 aaaaguaauuaaaa 
Get sequence
Deep sequencing
1757 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 10047746-10047815 [-]
sense
T16G12.1 ; T16G12.1; intron 6
Database links

Mature sequence cel-miR-1020-5p

Accession MIMAT0020356
Previous IDscel-miR-1020*
Sequence

1 - 

guaaguguuacagaauaaucuu

 - 22

Get sequence
Deep sequencing122 reads, 11 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence cel-miR-1020-3p

Accession MIMAT0005033
Previous IDscel-miR-1020
Sequence

50 - 

auuauucugugacacuuucag

 - 70

Get sequence
Deep sequencing1633 reads, 13 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).
2
3