Stem-loop sequence cel-mir-1019

AccessionMI0005880 (change log)
DescriptionCaenorhabditis elegans miR-1019 stem-loop
Stem-loop
   ---gu     u   uc     u  -       uaaa 
5'      gagca ugu  gaguu ca uuuuuaa    a
        ||||| |||  ||||| || |||||||     
3'      uucgu aca  cuuaa gu aaaaauu    u
   gaccu     u   -c     u  c       uauu 
Get sequence
Deep sequencing
91 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The 5' mature sequence was erroneously named mir-803 in [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 9361597-9361665 [+]
sense
M04C9.5a ; M04C9.5a; intron 5
M04C9.5b ; M04C9.5b; intron 5
Database links

Mature sequence cel-miR-1019-5p

Accession MIMAT0005822
Previous IDscel-miR-1019*
Sequence

1 - 

gugagcauuguucgaguuucauuuu

 - 25

Get sequence
Deep sequencing85 reads, 13 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence cel-miR-1019-3p

Accession MIMAT0005032
Previous IDscel-miR-1019
Sequence

46 - 

cuguaauuccacauugcuuuccag

 - 69

Get sequence
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).
2
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).