Stem-loop sequence cel-mir-1018

AccessionMI0005879 (change log)
DescriptionCaenorhabditis elegans miR-1018 stem-loop
Literature search

1 open access papers mention cel-mir-1018
(1 sentences)

Stem-loop
   --         -         c   aua 
5'   guaaguuca ugauuucuc cau   u
     ||||||||| ||||||||| |||   u
3'   cauucaggu acuagagag gua   u
   ga         u         a   cuu 
Get sequence
Deep sequencing
2723 reads, 6.25 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1879458-1879513 [+]
sense
Y59E1B.1 ; Y59E1B.1; intron 1
Clustered miRNAs
< 10kb from cel-mir-1018
cel-mir-4807chrX: 1872466-1872526 [+]
cel-mir-4808chrX: 1872952-1873008 [+]
cel-mir-4809chrX: 1873646-1873704 [+]
cel-mir-2220chrX: 1873827-1873884 [+]
cel-mir-4810bchrX: 1874016-1874075 [+]
cel-mir-4810achrX: 1875738-1875794 [+]
cel-mir-1018chrX: 1879458-1879513 [+]
cel-mir-4925chrX: 1879562-1879620 [+]
cel-mir-4923bchrX: 1879640-1879698 [+]
cel-mir-4923achrX: 1879876-1879936 [+]
cel-mir-4921chrX: 1879979-1880038 [+]
Database links

Mature sequence cel-miR-1018

Accession MIMAT0005031
Sequence

35 - 

agagagaucauuggacuuacag

 - 56

Get sequence
Deep sequencing2722 reads, 16 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).
2