Stem-loop sequence dme-mir-1012

AccessionMI0005873 (change log)
DescriptionDrosophila melanogaster miR-1012 stem-loop
Gene family MIPF0001046; mir-1012
Literature search

3 open access papers mention dme-mir-1012
(5 sentences)

Stem-loop
   --     u    -              gcu 
5'   guggg agaa cuuugauuaauauu   u
     ||||| |||| ||||||||||||||    
3'   uaccc uuuu gaaacugauuauaa   g
   ga     c    a              aaa 
Get sequence
Deep sequencing
39804 reads, 222 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 26861349-26861407 [-]
sense
FBtr0085097 ; Lerp-RB; intron 6
FBtr0085099 ; Lerp-RA; intron 6
FBtr0300939 ; Lerp-RD; intron 6
Database links

Mature sequence dme-miR-1012-5p

Accession MIMAT0020906
Sequence

2 - 

uggguagaacuuugauuaaua

 - 22

Get sequence
Deep sequencing27788 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-1012-3p

Accession MIMAT0005025
Previous IDsdme-miR-1012
Sequence

37 - 

uuagucaaagauuuuccccauag

 - 59

Get sequence
Deep sequencing12016 reads, 49 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).