Stem-loop sequence dme-mir-1007

AccessionMI0005868 (change log)
DescriptionDrosophila melanogaster miR-1007 stem-loop
Literature search

2 open access papers mention dme-mir-1007
(2 sentences)

Stem-loop
   --         -gu    a  cg   uu -   c 
5'   guaagcagu   uuga cu  auc  g guu u
     |||||||||   |||| ||  |||  | |||  
3'   cguuuguca   aacu ga  uag  c cag u
   ga         auu    c  -a   uu u   g 
Get sequence
Deep sequencing
1048 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 21296385-21296449 [-]
sense
FBtr0332488 ; CG1718-RC; intron 5
FBtr0332489 ; CG1718-RD; intron 6
FBtr0306679 ; CG1718-RB; intron 7
Clustered miRNAs
< 10kb from dme-mir-1007
dme-mir-2535bchrX: 21298275-21298345 [-]
dme-mir-1007chrX: 21296385-21296449 [-]
Database links

Mature sequence dme-miR-1007-5p

Accession MIMAT0020904
Sequence

5 - 

gcaguguuugaacucgaucuugg

 - 27

Get sequence
Deep sequencing386 reads, 32 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-1007-3p

Accession MIMAT0005020
Previous IDsdme-miR-1007
Sequence

43 - 

uaagcucaauuaacuguuugca

 - 64

Get sequence
Deep sequencing621 reads, 46 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).