Stem-loop sequence dme-mir-1006

AccessionMI0005867 (change log)
DescriptionDrosophila melanogaster miR-1006 stem-loop
Gene family MIPF0000873; mir-1006
Literature search

1 open access papers mention dme-mir-1006
(1 sentences)

Stem-loop
   --      uu         augcg        u 
5'   gugagu  gaaauugaa     uaaauugu u
     ||||||  |||||||||     |||||||| g
3'   uacuua  cuuuagcuu     auuuaaca g
   ga      uu         ---aa        u 
Get sequence
Deep sequencing
4394 reads, 36.7 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 16724795-16724858 [-]
sense
FBtr0080940 ; VhaSFD-RA; intron 3
FBtr0080942 ; VhaSFD-RD; intron 3
FBtr0080941 ; VhaSFD-RB; intron 4
Database links

Mature sequence dme-miR-1006-5p

Accession MIMAT0020903
Sequence

2 - 

ugaguuugaaauugaaaugcguaaa

 - 26

Get sequence
Deep sequencing261 reads, 41 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-1006-3p

Accession MIMAT0005019
Previous IDsdme-miR-1006
Sequence

42 - 

uaaauucgauuucuuauucauag

 - 64

Get sequence
Deep sequencing4124 reads, 49 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).