Stem-loop sequence dme-mir-1000

AccessionMI0005862 (change log)
DescriptionDrosophila melanogaster miR-1000 stem-loop
Gene family MIPF0000701; mir-1000
Literature search

4 open access papers mention dme-mir-1000
(5 sentences)

Stem-loop
   -------       gc  u  a  u       u a       --       ca 
5'        gacgcuu  ca ug ua uguccug c cagcagu  auuguaa  c
          |||||||  || || || ||||||| | |||||||  |||||||  u
3'        cugcgag  gu ac au acggggc g gucguca  ugauauu  a
   acgauua       uu  u  a  u       u g       uu       au 
Get sequence
Deep sequencing
38192 reads, 633 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 25588859-25588958 [-]
antisense
FBtr0305219 ; msi-RD; intron 2
FBtr0333665 ; msi-RH; intron 2
FBtr0333663 ; msi-RE; intron 3
FBtr0333664 ; msi-RF; intron 4
FBtr0305218 ; msi-RC; intron 4
FBtr0084881 ; msi-RB; intron 4
Database links

Mature sequence dme-miR-1000-5p

Accession MIMAT0005520
Previous IDsdme-miR-1000
Sequence

15 - 

auauuguccugucacagcagu

 - 35

Get sequence
Deep sequencing37077 reads, 45 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-1000-3p

Accession MIMAT0020900
Sequence

60 - 

cugcugggucggggcauuaaca

 - 81

Get sequence
Deep sequencing1099 reads, 41 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).