|
miRBase |
|
Stem-loop sequence dme-mir-252 |
|||||
| Accession | MI0005858 | ||||
| Description | Drosophila melanogaster miR-252 stem-loop | ||||
| Gene family | MIPF0000285; mir-252 | ||||
| Stem-loop |
accaa u cc a u c uuag - u gu cgcuuu uaaguacu g gc gcaggag guu cg g || |||||| |||||||| | || ||||||| ||| || cg gcgaaa auucguga c cg cguccuc uaa gc u -ugag - uu a c u --ca c c |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence dme-miR-252-5p |
|
| Accession | MIMAT0005516 |
| Previous IDs | dme-miR-252 |
| Sequence |
16 - cuaaguacuagugccgcaggag - 37 |
| Deep sequencing | 394963 reads, 50 experiments |
| Evidence | experimental; 454 [1-2], Solexa [2] |
| Predicted targets |
|
Mature sequence dme-miR-252-3p |
|
| Accession | MIMAT0020896 |
| Sequence |
60 - uccugcugcccaagugcuuauu - 81 |
| Deep sequencing | 8514 reads, 41 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 2 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|