Stem-loop sequence dme-mir-252

AccessionMI0005858 (change log)
DescriptionDrosophila melanogaster miR-252 stem-loop
Gene family MIPF0000285; mir-252
Literature search

8 open access papers mention dme-mir-252
(140 sentences)

Stem-loop
   accaa  u      cc        a u  c       uuag   -  u 
5'      gu cgcuuu  uaaguacu g gc gcaggag    guu cg g
        || ||||||  |||||||| | || |||||||    ||| ||  
3'      cg gcgaaa  auucguga c cg cguccuc    uaa gc u
   -ugag  -      uu        a c  u       --ca   c  c 
Get sequence
Deep sequencing
260216 reads, 7.43e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 13464219-13464311 [-]
sense
FBtr0309273 ; CR17025-RB; intron 1
Database links

Mature sequence dme-miR-252-5p

Accession MIMAT0005516
Previous IDsdme-miR-252
Sequence

16 - 

cuaaguacuagugccgcaggag

 - 37

Get sequence
Deep sequencing255486 reads, 49 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-252-3p

Accession MIMAT0020896
Sequence

60 - 

uccugcugcccaagugcuuauu

 - 81

Get sequence
Deep sequencing4603 reads, 37 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).